Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Detectability of NAAT on SARS-CoV-2 lineages - detail

Variant B.1.258.12

Number of times sequenced Worldwide
111
Perfectly matching
17
Non-perfectly matching
1
Non-targeted
0

Omicron-Method

Analysed on
2022-01-17
Forward primer mismatches
6
Probe mismatches
5

Amplicon

Ref	AACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Ampl	AGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Diff	.X..X.................X..........................X.......X......X.......X...........X.....................................................

WHO-1

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-2

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-3

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-4

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-5

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-6

Analysed on
2022-01-17
Perfectly matching
Yes

WHO-7

Analysed on
2022-01-17
Perfectly matching
Yes

JRC-S

Analysed on
2022-01-17
Perfectly matching
Yes

N-Sarbeco

Analysed on
2022-01-17
Perfectly matching
Yes

China-CDC-ORF1ab

Analysed on
2022-01-17
Perfectly matching
Yes

China-CDC-N

Analysed on
2022-01-17
Perfectly matching
Yes

RdRp-nCoV-IP2

Analysed on
2022-01-17
Perfectly matching
Yes

RdRp-nCoV-IP4

Analysed on
2022-01-17
Perfectly matching
Yes

HKU-ORF1b-nsp14

Analysed on
2022-01-17
Perfectly matching
Yes

HKU-N

Analysed on
2022-01-17
Perfectly matching
Yes

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2022-01-17
Perfectly matching
Yes

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2022-01-17
Perfectly matching
Yes