Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Detectability of NAAT on SARS-CoV-2 lineages - detail

Variant B.1.351

Number of times sequenced Worldwide
24996
WHO label
Beta
ECDC status
VOC
Perfectly matching
15
Non-perfectly matching
2
Non-targeted
0

China-CDC-N

Analysed on
2021-10-15
Forward primer mismatches
1

Amplicon

Ref	GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG
Ampl	GGGGAATTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG
Diff	......X............................................................................................

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2021-10-15
Forward primer mismatches
1

Amplicon

Ref	CAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGT
Ampl	CAGTAGGGGAATTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGT
Diff	...........X.........................................................................................

WHO-1

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-2

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-3

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-4

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-5

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-6

Analysed on
2021-10-15
Perfectly matching
Yes

WHO-7

Analysed on
2021-10-15
Perfectly matching
Yes

JRC-S

Analysed on
2021-10-15
Perfectly matching
Yes

N-Sarbeco

Analysed on
2021-10-15
Perfectly matching
Yes

China-CDC-ORF1ab

Analysed on
2021-10-15
Perfectly matching
Yes

RdRp-nCoV-IP2

Analysed on
2021-10-15
Perfectly matching
Yes

RdRp-nCoV-IP4

Analysed on
2021-10-15
Perfectly matching
Yes

HKU-ORF1b-nsp14

Analysed on
2021-10-15
Perfectly matching
Yes

HKU-N

Analysed on
2021-10-15
Perfectly matching
Yes

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2021-10-15
Perfectly matching
Yes