Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Detectability of NAAT on SARS-CoV-2 lineages - detail

Variant XBC.1.3

Number of times sequenced Worldwide
1455
WHO label
Omicron
ECDC status
Variant descalated
Perfectly matching
14
Non-perfectly matching
8
Non-targeted
-1

WHO-1

Analysed on
2024-06-17

Amplicon

Ref	GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA
Ampl	GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA
Diff	........................................................................

WHO-2

Analysed on
2024-06-17

Amplicon

Ref	TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC
Ampl	TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC
Diff	...................................................................

WHO-3

Analysed on
2024-06-17

Amplicon

Ref	GGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA
Ampl	GGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA
Diff	........................................................................

WHO-4

Analysed on
2024-06-17

Amplicon

Ref	ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT
Ampl	ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT
Diff	.................................................................................................................

WHO-5

Analysed on
2024-06-17
Forward primer mismatches
2

Amplicon

Ref	GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTG
Ampl	GTGAAATGGTCATGTGTGGCAGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTG
Diff	....................X...............................................................................

WHO-6

Analysed on
2024-06-17

Amplicon

Ref	CGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGG
Ampl	CGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGG
Diff	.........................................................

WHO-7

Analysed on
2024-06-17

Amplicon

Ref	AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCA
Ampl	AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCA
Diff	..............................................................................................................................................................

JRC-S

Analysed on
2024-06-17
Probe mismatches
2

Amplicon

Ref	GACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCA
Ampl	GACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAAGTCTCATCGGCGGGCACGTAGTGTAGCTAGTCA
Diff	..................................................X....X...........................

N-Sarbeco

Analysed on
2024-06-17

Amplicon

Ref	CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTC
Ampl	CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTC
Diff	................................................................................................................................

China-CDC-ORF1ab

Analysed on
2024-06-17

Amplicon

Ref	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT
Ampl	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT
Diff	.......................................................................................................................

China-CDC-N

Analysed on
2024-06-17
Forward primer mismatches
1

Amplicon

Ref	GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG
Ampl	TGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG
Diff	X..................................................................................................

RdRp-nCoV-IP2

Analysed on
2024-06-17
Reverse primer mismatches
1

Amplicon

Ref	ATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAG
Ampl	ATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACATAACAAAGGGAG
Diff	................................................................................................X...........

RdRp-nCoV-IP4

Analysed on
2024-06-17

Amplicon

Ref	GGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAG
Ampl	GGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAG
Diff	...........................................................................................................

HKU-ORF1b-nsp14

Analysed on
2024-06-17

Amplicon

Ref	TGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTTAAGCGTGTT
Ampl	TGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTTAAGCGTGTT
Diff	....................................................................................................................................

HKU-N

Analysed on
2024-06-17

Amplicon

Ref	TAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCG
Ampl	TAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCG
Diff	..............................................................................................................

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2024-06-17

Amplicon

Ref	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATG
Ampl	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATG
Diff	..............................................................................................................

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2024-06-17
Forward primer mismatches
1

Amplicon

Ref	CAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGT
Ampl	CAGTATGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGT
Diff	.....X...............................................................................................

Omicron-Method

Analysed on
2024-06-17
Probe mismatches
1

Amplicon

Ref	AACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Ampl	AACAAACCTTGTAATGGTGTTGCAGGTCCTAATTGTTACTTTCCTTTACAATCATATGGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Diff	...........................XX....................X.......X................................................................................

JRC-CoV-UCE.1

Analysed on
2024-06-17

Amplicon

Ref	ACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGC
Ampl	ACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGC
Diff	.........................................................................................

JRC-CoV-UCE.2

Analysed on
2024-06-17

Amplicon

Ref	AAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACA
Ampl	AAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACA
Diff	.....................................................................................

PiroMet-1

Analysed on
2024-06-17
Forward primer mismatches
4

Amplicon

Ref	CGGTAACAAACCTTGTAAAGGTAAAGGTCCTAATTGTTACTTTCCTTTACAATCATATGGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Ampl	CGGTAACAAACCTTGTAATGGTGTTGCAGGTCCTAATTGTTACTTTCCTTTACAATCATATGGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Diff	..................X...XXX.XXXX.XX.XX..XX.XXXX.XXXXX.XX..XXXX.XXXXXX.XXX.XXX.XX..X..X.XXX..X.X.XXXXXXXX.......X.XXX..X.XXXXXX..X.XXXXXX..X..