COVID-19 Test Method - detail | COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Reference Laboratory

NIID, Japan

Target Gene

N gene

Sample Size

no clinical samples

Validation Parameters

Not reported

(Units: cpr = copies per reaction, cpu = copies per microliter, cpm = copies per millilter)

Peer-reviewed

1

Reference amplicon

AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCA

Comparative analysis of primer-probe sets for the laboratory confirmation of SARS-CoV-2
Development of Genetic Diagnostic Methods for Novel Coronavirus 2019 (nCoV-2019) in Japan
Double-Quencher Probes Improved the Detection Sensitivity of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) by One-Step RT-PCR
Comparison of 12 molecular detection assays for SARS-CoV-2
Presence of mismatches between diagnostic PCR assays and coronavirus SARS-CoV-2 genome: Sequence mismatches in SARS-CoV-2 PCR