Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

SARS-CoV-2 NAAT methods - detail

Reference Laboratory
WHO / Charité, Germany
Target Gene
E gene
Sample Size
75 samples (tested in 5 labs)
Validation Parameters
Specificity tested, LOD: (E: 3.9, RdRp: 3.6)
(Units: cpr = copies per reaction, cpu = copies per microliter, cpm = copies per millilter)
Peer-reviewed
1
Reference amplicon
ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT

Related Scientific Literature