Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

COVID-19 Test Method - detail

WHO-2

Reference Laboratory
Institute Pasteur
Target Gene
RdRp-domain, nCoV_IP2-domain
Sample Size
no clinical samples
Validation Parameters
Specificity tested, LOD: (100 cpr)
(Units: cpr = copies per reaction, cpu = copies per microliter, cpm = copies per millilter)
Peer-reviewed
no
Last Update
11/05/2020
Reference amplicon
TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC