COVID-19 Test Method - detail | COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Reference Laboratory

US-CDC, US

Target Gene

N gene

Sample Size

no clinical samples

Validation Parameters

Not reported

(Units: cpr = copies per reaction, cpu = copies per microliter, cpm = copies per millilter)

Reference amplicon

GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

Comparison of abbott id now, diasorin simplexa, and CDC fda emergency use authorization methods for the detection of sars-cov-2 from nasopharyngeal and nasal swabs from individuals diagnosed with covid-19
Presence of mismatches between diagnostic PCR assays and coronavirus SARS-CoV-2 genome: Sequence mismatches in SARS-CoV-2 PCR