Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

Detectability of NAAT on SARS-CoV-2 lineages - detail

Variant B.1.619.1

Number of times sequenced Worldwide
1568
Perfectly matching
14
Non-perfectly matching
4
Non-targeted
0

WHO-1

Analysed on
2022-04-13
Probe mismatches
3

Amplicon

Ref	GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA
Ampl	GACCCCAAAATCAGCGAAATGCACTCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA
Diff	........................X...............................................

WHO-2

Analysed on
2022-04-13

Amplicon

Ref	TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC
Ampl	TTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGC
Diff	...................................................................

WHO-3

Analysed on
2022-04-13

Amplicon

Ref	GGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA
Ampl	GGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA
Diff	........................................................................

WHO-4

Analysed on
2022-04-13

Amplicon

Ref	ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT
Ampl	ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT
Diff	.................................................................................................................

WHO-5

Analysed on
2022-04-13

Amplicon

Ref	GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTG
Ampl	GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTG
Diff	....................................................................................................

WHO-6

Analysed on
2022-04-13

Amplicon

Ref	CGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGG
Ampl	CGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGG
Diff	.........................................................

WHO-7

Analysed on
2022-04-13

Amplicon

Ref	AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCA
Ampl	AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCA
Diff	..............................................................................................................................................................

JRC-S

Analysed on
2022-04-13

Amplicon

Ref	GACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCA
Ampl	GACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCA
Diff	...................................................................................

N-Sarbeco

Analysed on
2022-04-13

Amplicon

Ref	CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTC
Ampl	CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTC
Diff	................................................................................................................................

China-CDC-ORF1ab

Analysed on
2022-04-13

Amplicon

Ref	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT
Ampl	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT
Diff	.......................................................................................................................

China-CDC-N

Analysed on
2022-04-13
Forward primer mismatches
1

Amplicon

Ref	GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG
Ampl	GGGGAATTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAATCAGCTTGAGAGCAAAATGTCTG
Diff	......X.....................................................................X......................

RdRp-nCoV-IP2

Analysed on
2022-04-13

Amplicon

Ref	ATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAG
Ampl	ATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAG
Diff	............................................................................................................

RdRp-nCoV-IP4

Analysed on
2022-04-13

Amplicon

Ref	GGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAG
Ampl	GGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAG
Diff	...........................................................................................................

HKU-ORF1b-nsp14

Analysed on
2022-04-13

Amplicon

Ref	TGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTTAAGCGTGTT
Ampl	TGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTTAAGCGTGTT
Diff	....................................................................................................................................

HKU-N

Analysed on
2022-04-13

Amplicon

Ref	TAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCG
Ampl	TAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCG
Diff	..............................................................................................................

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2022-04-13

Amplicon

Ref	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATG
Ampl	CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATG
Diff	..............................................................................................................

Diagnostic Kit for SARS-CoV-2 Nucleic Acid(RT-PCR)

Analysed on
2022-04-13
Forward primer mismatches
1
Reverse primer mismatches
2

Amplicon

Ref	CAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGT
Ampl	CAGTAGGGGAATTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAATCAGCTTGAGAGCAAAATGT
Diff	...........X.....................................................................X...................

Omicron-Method

Analysed on
2022-04-13
Forward primer mismatches
7
Probe mismatches
5

Amplicon

Ref	AACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Ampl	AGCACACCTTGTAATGGTGTTAAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA
Diff	.X..X................XX..........................X.......X......X.......X...........X.....................................................