Skip to main content
COVID-19 In Vitro Diagnostic Devices and Test Methods Database

SARS-CoV-2 target regions - detail

enabled by data from

Amplicon collected by in silico WHO-1 screening of GISAID : EPI_ISL_420600 viralgenome, collected on 07/03/20

Source
GISAID
Accession ID
Host
Human
Region
South America
Country
Argentina
Collection Date
07/03/20
Testing Method

Amplicon

Ref	GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA
Diff	........................................................................

The database contains amplicons collected by screening viral shared genomic sequences of SARS-CoV-2 by in silico determination of PCR-based molecular assays to diagnose COVID-19. The information is retrieved periodically. Acknowledgements

GISAID data provided on this website are subject to GISAID's Terms and Conditions